Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14696G10
Clone ID IST14696G10
Vector VICTR76
Project tigm

Sequence tag IST14696G10HMR1
Sequence
ANACCTCGTTTCCTGTGTAGCCCAGGCTGATTTAGGAAACTTGATCCTCTTTTCCCCCACCTCCCTATGCTGGCTTTTAC
ACCCCTGGCTTCTAAACAAATTCTTTTTCANTGGGGAAAAGGACGTCTTTAAAATTTTGTGGTTCTGGGTTTTTTTGTTG
TTGTTTTTTTTTTGGTTTTTNGNTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI15795

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147524335..147524523 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055401 (Fbxo6) NM_015797 F-box protein 6 Gene [Source:MGI (curated);Acc:Fbxo6-003]

 
Come back to gene ENSMUSG00000055401


For any suggestions or comments, please send an email to unitrap@crg.es