Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A052A08
Clone ID A052A08
Vector pT1betageo
Project ggtc

Sequence tag A052A08
Sequence
AAAGTTCGTGCATGAGAAGGAGATCATGGCAGAAGATGACCAAGTGTTTCTGATGAAGCTACAGTCTCTTTTAGCAAAGC
AACCTCCAACTGCAGCTGGAAGGCCTGTGGATGCATCACCAAGAGTCCCTGGAGGCTCCCCTCGAACACCAAACAGATCT
GTGTCATCCAATGTTGCCAGTGTGTCCCCCATCCCTGCTGGATCCAAAAAAATTGATCCAAACATGAAAGCTGGAGCGAC
CAGCGAAGGGGTCCTGGCGAATTTCTTCAACAGTCTGTTGAGTAAGAAGACTGGCTCTCCTGGAGGCCCCGGGGTCGGCG
GCAGTCCTGGAGGAGGGGCTGCAGGTGCAAGCCCCAGTTTGCCTCCGTCCGCCAAAAAGTCAG
Sequence Type mRNA
Unitrap ID UNI12277

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114626979..114630975 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032435 (Dync1li1) NM_146229 dynein cytoplasmic 1 light intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:2135610]

 
Come back to gene ENSMUSG00000032435


For any suggestions or comments, please send an email to unitrap@crg.es