Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14392D12
Clone ID IST14392D12
Vector VICTR74
Project tigm

Sequence tag IST14392D12HMR1
Sequence
CTTATGAGCAGGGAGTTGTGAGAATGCAGCGTGACATAGTATCCGAGAGAAGATCGGAATCTGATTGAGGTCACTGCCNA
GTTANGTGTTTTAAAAGAACTAACCTAGGAGTCTTTCTGGAGTCTGGGCTTCTCCCNNCTGTGCTGGGATTCGCGTGN
Sequence Type genomic DNA
Unitrap ID UNI10762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49777836..49777992 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]


Sequence tag IST14392D12HMF1
Sequence
AAGCCACCAAGGTCCCACTAAGTGAAGGGGGTACTTCTAAGGATCTCAGTCCTCCACCCAACGAGTCAGGCCAGAATCTG
CGGGCAGCTCTGAGTTCTGCAATGTTACTCTCCCTCCACGAAAGCTCTCTGGAAATAGCTTTGTGCCCGCAGCTCACTCA
CAGTGAGAAGCAGCGTGCTCCTTTTTCACCGCCTCGTGCTGTCTGGAGGTTGTTACACGGGCGGGCCTCACTCTGCGGCC
CAGAAGGACAAGANGGTGCGGCTTACCTGGGAACCCGGANAGCTCGCTCAGGTTGCAGCCTGCGACCACGTTCCGCGTCT
GGANGTGATGCANTACTGACNGTGCCANGCTCAACCNCTCCGCGGCGCCCAATCAGCGTGTGCCATCCAACACCTACAAN
CNACNCNTGTGGCNATTGGTCCGTGCNTAACTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49777405..49777838 408
 
EST/CDNA Est Name
  BB669313.1

 
Come back to gene BB669313.1


For any suggestions or comments, please send an email to unitrap@crg.es