Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14657G8
Clone ID IST14657G8
Vector VICTR74
Project tigm

Sequence tag IST14657G8HMR1
Sequence
GGTCNGTACTTTGAATATTTCAAATTCATTTTTAATTTCTAATATAAGCATTGATTGAGAAAGCCTACATCTGTAAGAAG
TCTCTTTGTATATCTTGGCTAGGCAGAGTGAGTACTCCTTGGGATGCAGAAGTAGGTGGGTCTTGAACTGTATAGCCTGG
GCTATACAGTAAAATGCTGTCTCAAAACAAANAANAAAAATANCANTGTACTTTTAAAAGGGTGGATTGTATGGCATGTG
ATTCNTGTCC
Sequence Type genomic DNA
Unitrap ID UNI530

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104442890..104443138 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027176 (Cstf3) NM_145529 cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI (curated);Acc:Cstf3-001]


Sequence tag IST14657G8BBF1
Sequence
ACCTCAGAAGCCTGGTCTACAGTGTCAATTCCAGGACAGCCAGAGCTAACCAAAAACAAACAAACAAAAAAAACCCTGTC
TTGAACCCCCCCTACTCCCGCCAAATCACTATGTATTTTATAAAAATGTACTTTTACAAGAAAAAGATGGCTGTGATTGT
TTTATACACAGAACAATCAAATTTAGGTACTGTGCATGTCAGTAAAAACTCTACTACTGAGCTACTCCCCAACCAACAAA
TTATTTATCTGGGTGATCTTTTAAGCACCTGAGGGGCTGAANAGATGGTTCGTTAANAGTCCTGTCTGCTATTCCAAAAA
ACTTGGGTTCAGTTCCCAGCACGCGGGATGGTGACTCCTAACCNTCTCTTAACTCCNGTTCCNNAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104442503..104442892 376
 
EST/CDNA Est Name
  BX633718.1 - CO039347.1 - DY247752.1

 
Come back to gene BX633718.1 - CO039347.1 - DY247752.1


For any suggestions or comments, please send an email to unitrap@crg.es