Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A057E07
Clone ID A057E07
Vector pT1betageo
Project ggtc

Sequence tag A057E07
Sequence
AGTGCTTGAATGGTTCTGTGTGCCGTGATCCGTTTCATGCGGTTGGATACTGTGGATTGTGCACAGGCAAGCTCCGAAGT
TGCGACATGGATGTGTTGACCCATGATGATGTGCATGTGAACTTCACTCGAGAAGAATGGGCTTTGTTGAATCCTTCACA
AAATAGCCTCTACAAAGATGTGATGCTGGAGTCCTATAGGAACTTCAATGTTATAGGCTACAGTTGGTGCAGCCAATAAT
ACTTAAGGGNNAGTGTCCAAGTTCNAAAAAAATAAGGAAG
Sequence Type mRNA
Unitrap ID UNI12282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98218513..98229921 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079490 (AC163298.4)  

 
Come back to gene ENSMUSG00000079490


For any suggestions or comments, please send an email to unitrap@crg.es