Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14346B5
Clone ID IST14346B5
Vector VICTR74
Project tigm

Sequence tag IST14346B5HMR1
Sequence
NTNNCTGTCTTGTTNATTAGAACTCTTTGTTTTCAAATGTAAATGACTGAAGACTTTTGTGAGAATTGTCAGTGGTCTCA
AGAAAATGTTCATCTACTCAAAAAAAAAAAAAT
Sequence Type genomic DNA
Unitrap ID UNI15133

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9109451..9109558 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033499 (Larp5) NM_172585 La ribonucleoprotein domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:106330]


Sequence tag IST14346B5HMF1
Sequence
AGAGCAGCCTCTGTCAGGGATTCCATCATCAAATGTCCACAGATTATGATGGATGCTTTTGATGGCCAGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 143112774..143112843 70
NO GENE  

 
Come back to gene ENSMUSG00000033499


For any suggestions or comments, please send an email to unitrap@crg.es