Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A045C01
Clone ID A045C01
Vector pT1betageo
Project ggtc

Sequence tag A045C01
Sequence
CTAAATTTGATGATGGAGATGTAACGGAATGTAAAATGGATGACGATGAAGAAATGAAAAACCAGTGTTTTGGGGGAGAG
TACATGGGAGAAGTATTTGATCACATGATGAAGCGCATGTCGTACAGGCGTCAGAAAAGATGGTGGAATGCATATATACT
TTTTTATGAACGAATGGACACAATAGGTCATGATGATGAGGTGATAAGATACATATCAGAGATTGCTATCACCACAAGGC
CCCATCAGATTGTCATGCCATCCGCCATTGAAAGAAGTGTTCGGAAGCAGAATGTTCAGTTCATGCACAACCGAATCCAG
TACAGTATGGAAATGGTCGGGGGAGCTCCACAGGAAAGGCANTGTCNNTGNNNTTACATTGGAGCCATCGGNNNAGGT
Sequence Type mRNA
Unitrap ID UNI12284

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12733482..12733812 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es