Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AZ0887
Clone ID AZ0887
Vector pGT0lxr
Project sanger

Sequence tag AZ0887
Sequence
TGAGCTCTTCTAGATGGCTGAGGTGCACCGGCAGATCCAGAACCAGTTGGAAGAGACGCTGAAGTCTTTTCACAATGAGC
TGCTCACTCAGCTGGAGCAGAAAGTAGAACTGGACTCCAGGTATCTAAGTGCTGCACTGAAGAAATACCAAACGGAACAG
AGGAGCAAAGTGGACGCCCTGGACAAGTGTCAGGCTGAGCTGAAGAAGCTCCGCAAGAAGAGCCAAGGGAGAAGAACCCT
CAGAAGTATTTAGACAAGGAGCTGCAG
Sequence Type mRNA
Unitrap ID UNI1843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119842111..119843440 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025372 (Baiap2) NM_001037755 brain-specific angiogenesis inhibitor 1-associated protein 2 Gene [Source:MGI (curated);Acc:Baiap2-005]

 
Come back to gene ENSMUSG00000025372


For any suggestions or comments, please send an email to unitrap@crg.es