Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13361E7
Clone ID IST13361E7
Vector VICTR74
Project tigm

Sequence tag IST13361E7BBF1
Sequence
GTTGCTCCCTTCAGCTCTGCTCTANATCACGGGTCTTCCCCTGGCCCTATGACAGCTGTGGTAAGGGCANCATTAANAGC
AGCACCCCACGGACCTCACACCTTGGCCAGAGTCAGCTGGCTAAGTGCAGATGGCAGGCCACATTCACTCCCTCCTCTCC
CCANTCCTGGGTAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79458607..79458785 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]


Sequence tag IST13361E7HMF1
Sequence
GTTGCTCCCTTCANCTCTGCTCTAGATNACGGGTCTTCCCCTGGCCCTATGACAGCTGTGGTAAGGGCANCATTAANAGC
ANCACCCCACGGNCCTCACACCTTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es