Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A044F04
Clone ID A044F04
Vector pT1betageo
Project ggtc

Sequence tag A044F04
Sequence
GGAGACTTCGAGAACAGGAGAGGGAGGAGAAGGAGCGGCGCAAGGAGCGGGCAGAGCGTGGGGGCAGCAGTGGAGAGGAG
CTGGAGGACGAGGAGCCTGTGAAGAAGCGTAGCCGAAAGGCTGGAGGCCGAGGCACACCATCCTCCTCTGACTCAGAACC
TGAGGGGGAGCTTGGGAAAGAGGGGAAGAAGTTGGCCAAGAAGTCCCAACTGCCAGGCTCAGAGTCTGCAAGGAAGCCTG
GGCAAAAGGAGAAGAGAGGGCGGCCAGATAGAAGCCACGAGCCAGGCCTGTGAAGGTGGAGCGTACGCGGAAGCGGTCAG
AGGGTCTCTCACGGAAAGGAAGGGGGAGAAGAAGAAAG
Sequence Type mRNA
Unitrap ID UNI12288

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56236768..56237409 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002833 (Hdgfrp2) NM_008233 hepatoma-derived growth factor, related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1194492]

 
Come back to gene ENSMUSG00000002833


For any suggestions or comments, please send an email to unitrap@crg.es