Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10893G2
Clone ID IST10893G2
Vector VICTR76
Project tigm

Sequence tag IST10893G2HMR1
Sequence
TATCTTGCCCACCCCACCAGCCCACGCTGCTTGGGACTTGAGATCTGTGGCCGAAGGACCGTCACCACATAACTTCAAAA
ATAATCAACCACCTTCCCTGCCCAAACCTACCCAATCTCACTCATCCAGCATTTCCGTTTTGGAATCCACTCANACTTTT
TTTTTCAACGACCCCCTCTCCCTAAATGGAGTTGGGCGGGGGGGAAATGAAAACTGAGTTGGTCTTTACTTTTTTTAAAA
NANACTTTTTGATCCNATGAGGCCCCACAAGTAACTGANTTTGGGTCCTGGTTGGTTGCTTTATTTN
Sequence Type genomic DNA
Unitrap ID UNI2151

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054289..36054594 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]


Sequence tag IST10893G2HMF1
Sequence
ATAGGTGGGGAGGGGCAGAANACACGAGTGGTTGGGCTGGTGGCTGATTTCCCTTTCCCCCCTCTCAGGATCCTTTCNAG
GGTTNANATGTTGCTGAGGCTTGTTTGTTTTCCTGATGGCCGGCCTGTCTTTCTCCGANAAAATTCNACCTGGGGTAAAA
GGAACACANANGGAGGAAGGTGTAATCNNTNCNGGTCGCCTTTAAACGTTTCANAGTTGTCNCANGACGCAGCCGCATTA
NGGAAAAACGTGNNTNNNNNTTNAATCCNAAACCACCCCGTTCCCCCGGCCCGCTCTCGGCAAAACGTTACCCTCNNNAN
CGACNGANCACCCNNACTTACCTCTNNNNAACCCCNANANTGGNNNNCGCCCGCTCGGGCGGANTCTNTTTATACCCGGN
CACNGNCCANCNCACCCCNANGTGATGNANAANCCGCCCTCGCN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10893G2BBF1
Sequence
ATANGTGGGGAGGGGCAGAAGACACGAGTGGTTGGGCTGGTGGCTGATTTCCCTTTCCCCCCTCTCAGGATCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054220..36054291 70
NO GENE  

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es