Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14635D2
Clone ID IST14635D2
Vector VICTR74
Project tigm

Sequence tag IST14635D2HMF1
Sequence
AAGTGTNNNATTGAATGACAGAAGGAAAGAAAAAAATTAAGTCCAAAATGTTCCTTANAAAGTCAGACAAAAGATAGGGC
CAGATGGGCCCAGTTTTAAACTACAAAGGAACACTGAAAAGTAGTGGTAGAAATATTTCAAAATTGAAACCACAACTAAT
CTTACATTAGTTTCTTCAAAGACCCAGAAGCAATCTTAATTGCAAATCAAGGTAGCCAACATTCCAAGAAAAATGCAACC
TTCCAAGCATTGAAGGTAAGTTTGGCTAATTATTATAAAAACACTGCCTTAGCAACAGACAGGGGTAAGGAGGAGTTGAG
TGTAAAGTAGGCAGAGCAAGCAGTTCTCTCTGATTCAGCACAGGCACGACAGCTGCAAAAAGTGGGAAGCAGANAAATTG
GTATCCAGAAATCANAAACAGGTTGTCATTTCACCAGAATTTACACCACANNTTCCNAATATCAATTCCNTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35525285..35525760 456
NO GENE  


Sequence tag IST14635D2HMR1
Sequence
ACTTCATAGTAGCTTCTAGGCACCNNCTTACCTCCNNGTGGTGGGTCNGTGTCAANAGTACATATGGCTTTCTAGTATAA
GATTGTAATTGTATGAGCTTGTAATTTTAAAGTTGTATAGATTTATAAATTCTTTTTTGTTTTCTGAATTANTTTATATA
GGTTGTTAATTTAAAAACAGAATCTCGTAACTGAAGAGACTTTAAAGGACAAGTACTCCCACATCTCACCCAAGAACAAA
TGTTCTTCCACACAGTGCTTGTTTTAGCAGTTANAATTCACTCTCCCAAAACAGCTTGTTTTTGTCCAGTGTATTTATTT
AGTGAGTGTTGCTTTTCTATTTGAGGATTTACCTCCCATTTTTGGANCCNNACATCTANGTGGTGGTGATTTCTAANNAN
Sequence Type genomic DNA
Unitrap ID UNI4014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35525757..35526153 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]


Sequence tag IST14635D2BBF1
Sequence
AANTGTNNTATTGAATGACAGAAGGAAAGAAAAAAATTAAGTCCAAAATGTTCCTTANAAAGTCANACAAAAGATAGGGC
CAGATGGGCCCAGTTTTAAACTACAAAGGAACACTGAAAAGTAGTGGTAGAAATATTTCAAAATTGAAACCACAACTAAT
CTTACATTAGTTTCTTCAAAGACCCAGAAGCAATCTTAATTGCAAATCAAGGTAGCCAACATTCCAAGAAAAATGCAACC
TTCCAAGCATTGAAGGTAAGTTTGGCTAATTATTATAAAAACACTGCCTTANCAACAGACAGGGGTAAGGAGGAGTTGAG
TGTAAAGTAGGCAGAGCAAGCAGTTCTCTCTGATTCAGCACAGGCACGACAGCTGCNAAAAGTGGGAAGCAGAGAAATTG
GTATCCNGAAATCNGANACAGGTTGTCNTTTCACNNNAATTTACACCACANNTTCCAAATATCNTTCCTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35525284..35525760 439
NO GENE  

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es