Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14391A9
Clone ID IST14391A9
Vector VICTR74
Project tigm

Sequence tag IST14391A9HMR1
Sequence
GGTTGGCCTCAAATTCCNGAGATCTGCCTGCCTCTACCTCTCAAGTGCTGAGATTGAAGGCATGTGCCAACACAACCCGT
ATTGAATTGTTC
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92043482..92043573 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]


Sequence tag IST14391A9BBF1
Sequence
ACCTGGTCTCCAGAGAGTATTCCAGGACAGCCATGGATACACAGATAAACTCTGTTTCAAAAACAAAAAACTACCAGCTG
GTATTTGGCAATTATCAACTAATGAACCATACATTACCGATATATACTAATAAGACAACATAAACCTATTTTGCATTTTA
CAAACCCAAACAATTCTAATTTCTATATTAATAAGTTAAAAAACTTGTAAAAGCAGTAATATAAAATATCTCTTTTCTTC
TGTTAGGTCCCTACCACTACAGANAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92043215..92043484 268
NO GENE  


Sequence tag IST14391A9HMF1
Sequence
ACCTGGTCTCCAGAGAGTATTCCAGGACAGCCATGGATACACAGATAAACTCTGTTTCAAAAACAAAAAACTACCAGCTG
GTATTTGGCAATTATCAACTAATGAACCATACATTACCGATATATACTAATAAGACAACATAAACCTATTTTGCATTTTA
CAAACCCAAACAATTCTAATTTCTATATTAATAAGTTAAAAAACTTGTAAAAGCAGTAATATAAAATATCTCTTTTCTTC
TGTTAGGTCCCTACCACTACAGAGAGATCTAATTCATTAAAGTCTTAGTTTTATTAGTGGCAAGCCTGACATCTCTACTT
CACCCTCTACCAAAAATACAGCAATTTCTGAGGTAAAAGGTCTTTTGTTTTTGCTTTGGGCTTGGGTTGGTTGGCTTGTT
C
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92043085..92043484 400
 
EST/CDNA Est Name
  BF467383.1

 
Come back to gene BF467383.1


For any suggestions or comments, please send an email to unitrap@crg.es