Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14592B3
Clone ID IST14592B3
Vector VICTR74
Project tigm

Sequence tag IST14592B3HMR1
Sequence
NCCCATACCCTGTTNATCCCTCCACTCTAACTCCGCCCAGTTGTCAGTTCTCTGTTGCATATGTGTTGCATTGCTGATTA
CGTCATCCTTACATGTTAGCATCATTGCTTATGCGTTATCTTCATTGCTTCCGTGCCAGCATTGCTGCTTATGTGTTANC
ACTGTTGTTTACNTGTCANCATTGTTGTTACATGTTGGCATCATTGCTTACATCATTGCTTATGTGTCAGCATTGCTGCT
TACATTGTTGCGACGTGTNNNCATCGCTCTTTGCTTATTAN
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121258339..121258617 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST14592B3HMF1
Sequence
GGGTCACCTCTTTTACTACTCTGGACTTTAGATCATATTCATGTTTCATATGATCTCAAAATTAAAATAAGTCACCCTGA
AATCAGGAGCAGCAAGAGACCAACTTAATCATCAAAGCAGTGAGCTATTCAGAAGGACTAACCTAGCCTAGATGCTTAAA
CCTGTGATTCTGTGTGCCCGTGCTAAGAGATTTCTAAAGAAGAAATAAACTTCAAATTCCTAAGTTCAGTAGAGGGAAGG
AGCTGATGCTGAAATCATGGACACACTCAGTGAATATATATACTCAGTAGTATACATGTACACTAATGTACATATTATAT
ATACATTTACAAGCTATGCTGTATACAATGCAAATATGCTGCTTACAAACAGGCTTTTCTTTTTCTGTTCAGCAGGAGGC
ATTAGTTGGAGANGCAGGGGNTGTGTTTTGGGCGGGANTNNNCNNATCNNTTNNCNGTGANTGCAANCNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121257875..121258340 438
 
EST/CDNA Est Name
  BB861417.1


Sequence tag IST14592B3BBF1
Sequence
GGGTCACCTCTTTTACTACTCTGGACTTTAGATCATATTCATGTTTCATATGATCTCAAAATTAAAATAAGTCACCCTGA
AATCAGGAGCAGCAAGAGACCAACTTAATCATCAAAGCAGTGAGCTATTCAGAAGGACTAACCTAGCCTAGATGCTTAAA
CCTGTGATTCTGTGTGCCCGTGCTAAGAGATTTCTAAAGAAGAAATAAACTTCAAATTCCTAAGTTCAGTAGAGGGAAGG
AGCTGATGCTGAAATCATGGACACACTCAGTGAATATATATACTCAGTAGTATACATGTACACTAATGTACATATTATAT
ATACATTTACAAGCTATGCTGTATACAATGCAAATATGCTGCTTACAAACAGGCTTTTCTTTTTCTGTTCAGCAGGAGGC
ATTAGTTGGAGAGGCAGGGGGTGTGTTTTGGGCGGGAGTNNGCAAATCCTTTAACTGTGAATGCAAANAGTCCCTCNCAC
CANGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121257856..121258340 475
 
EST/CDNA Est Name
  BB861417.1

 
Come back to gene BB861417.1


For any suggestions or comments, please send an email to unitrap@crg.es