Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14180B2
Clone ID IST14180B2
Vector VICTR74
Project tigm

Sequence tag IST14180B2HMF1
Sequence
GAAATATCTACTCTTCTAGCCCTCTAGGTAAACCTAAATTTTTAACTCAGACTGAAAACCACGTGCTGGAAATGTCCTGA
GACTGGGGGTAACAGCTGCCACCTGTGTGCTCTAGGGGGGCGGGGATGTACATCCACTGCTCCGCCTCGAGAATGTTGAT
TTACCTGCTTGAAAGACAAAATCTTGAAAGACAGTGAGAAAGTAGGAAAGCAGAACTTCTTTTGGGGAACTCTAGGTACT
TTATTTAAATGCAAACTGTAAAGCTGAGGCTAGTCTCCGGCCTCCTGTTGGGGAGCTGGCTCANAGAGTANCTTTTTCGG
AGCCTGNNTCCTCAANCCGACTTTTAAGCANAAGAGTAATTTTAGTCCTCAAGGTGATACTTTAGAAGATTTANAATCTG
TGTTCATCTANCANATTNATTTATCTGGCAGCCACTGCGCTCTATCTTNNTCTCGTGN
Sequence Type genomic DNA
Unitrap ID UNI15589 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115777942..115778398 433
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136941037..136941493 433
 
EST/CDNA Est Name
  BG073349.2 - AW549398.2 - AW549465.2
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52918727..52919183 433
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7470311..7470767 433
NO GENE  

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es