Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12483E12
Clone ID IST12483E12
Vector VICTR76
Project tigm

Sequence tag IST12483E12BBF1
Sequence
CCAGTTTTNAAGACAGCGAGAGATGTACAATCTAGATTTGTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
TNTN
Sequence Type genomic DNA
Unitrap ID UNI11698

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123376720..123376800 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]


Sequence tag IST12483E12HMF1
Sequence
CCAGTTTTCAAGACAGCGAGAGATGTACAATCTAGATTTGTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
TCTN
Sequence Type genomic DNA
Unitrap ID UNI11698

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123376718..123376800 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es