Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14106C1
Clone ID IST14106C1
Vector VICTR74
Project tigm

Sequence tag IST14106C1BBF1
Sequence
AACACACAAGCCCACATTAGAAAAGACAAACCAGCTAGTGGCCACCATTAGCCTCTTCTGAATTGAGCCCGTCTGGCCCC
GCCCAGGACCGCAGAGGTTTCTAAGGACCCGCCCACCGGTGCTAGTTTCCCAAAAACCCGTGCGGCAGACTCCAGCCGCT
CCAAGATGGCGACTCCCATGCATCGGCTCATAGCTCGAAGGAAAGCGTAAGTGAGATGCTTGTGGGGTGTGCAGGAGGGC
TGGN
Sequence Type genomic DNA
Unitrap ID UNI11583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53138038..53138280 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]


Sequence tag IST14106C1HMF1
Sequence
AACACACAAGCCCACATTAGAAAAGACAAACCAGCTAGTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53138038..53138081 44
NO GENE  

 
Come back to gene ENSMUSG00000018239


For any suggestions or comments, please send an email to unitrap@crg.es