Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F15228
Clone ID F15228
Vector pT1ATGbetageo
Project ggtc

Sequence tag F15228
Sequence
GGGGCTGTNNNNGCTGGCTCCTTCTCGATNNNCAGNTTGGGCGTCCATCGGGCAGACCTGTGCGCGCNNGTNNNTCNTNA
CCCGGGGCCCAGTTCTTTGAGGACCATGTCNNTGGAGTTTGGCAGTGTAGCACTGCAGACACAAAATGAAGATGAAGAAT
TTGACAAAGAAGACTNTNAAAGGGAAAAAGAGTTGCAGCAGCTACTCACAGACCTCCCTCACGACATGCTGGACGATGAG
CTCTCCTCTCCTGAGCGCCACGATTCTGACTGCAGTATGGACGGCAGAGCGGCAGAACCGCATCCTTCTGAGCATCTGGA
AAGGAAGTGGATTGAGCGGGATATACTGCCCAAGCCTCACAGCATGAACTGTGGCAATGGCTGGGAAGAAAATCGAAGTA
AAACCGAAGACCAGCATCTTGGGTACCACCCTGGAGAAGGTGGGGATGAAGGCGGAAGTGGCTATAGCCCTCCAGGTAAA
CGGGAGCAGGCAGATTTGTATCGCCTTCCTGAAGACTTTAGGCCATACACCGGCGGTTCGAAGCAGGCAGCCAGCGTGAT
TACGTTTTCAGATCCTCAGAGGGACAATTTTCAGCAATTTGGTTTATCTCGAGGACCCAGCTGTGGAGCTTTGGAGCCGT
ATAAAGCTGTATATAAGCCTTACCGTAACTCCTCTGTGCAGAAGAACAGCTCGCCAGCCCAGGAGGTAGCAGCAAGTGAC
ATGTTTGAAGGCTTGCAGCAACAGTTTTTAGGAGCTAATGAAA
Sequence Type mRNA
Unitrap ID UNI12301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 125444109..125450712 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068394 (Cep152) NM_001081091 centrosomal protein 152 Gene [Source:MGI (curated);Acc:Cep152-001]

 
Come back to gene ENSMUSG00000068394


For any suggestions or comments, please send an email to unitrap@crg.es