Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10083E1
Clone ID IST10083E1
Vector VICTR75
Project tigm

Sequence tag IST10083E1BBR1
Sequence
GGGCAAAGCAGGAAAGTGCACCGGTACCTCCTGTTGGGCATTTAGGATAAAAGACGAGGCAAACCACACCAATGCTTGCT
TGTACAGGGCTTGGGGGGGCAAGCCTGGGGTGGGATCCGT
Sequence Type genomic DNA
Unitrap ID UNI23198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75393831..75393949 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000901 (Mmp11) NM_008606 matrix metallopeptidase 11 Gene [Source:MGI (curated);Acc:Mmp11-002]

 
Come back to gene ENSMUSG00000000901


For any suggestions or comments, please send an email to unitrap@crg.es