Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15069E4
Clone ID IST15069E4
Vector VICTR80
Project tigm

Sequence tag IST15069E4HMR1
Sequence
CTTTNANTTTAANCCTTCTANCATACATCTGGAGACAGGGTCTCTCACTGAACCTTGAGCTTACTGATCTAAACATAGGT
CCACTTGCTCACAGAGTAAGTCATCTCCCCAGACCCAGATCTGGACTTTAACATGCACCCAGAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI12880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114467968..114468114 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]


Sequence tag IST15069E4HMF1
Sequence
CTCTCTGGACAATAATGATACCCTGTCTCAAATACACACACAATAAATAAGTAAATAAATAAATAAATAAATAAATAAAT
AAATAAATAAGCAAACAAATAAGGACTTGACGAGACAGCTCTGTTGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29591501..29591631 131
NO GENE  

 
Come back to gene ENSMUSG00000031950


For any suggestions or comments, please send an email to unitrap@crg.es