Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14637A4
Clone ID IST14637A4
Vector VICTR74
Project tigm

Sequence tag IST14637A4HMR1
Sequence
CTCCGGGGGCTTCGTACAGAGGCCGAGAGGGCGCGCCAGGCCCAGAGCCGTGCCCAGGAGGCCCTGGACAAAGCCNAGGA
GAAGGACAAGAANGTGGGTTCCCTCCTTGCTCACTGTTGGTGTCCACTAACCCGAGATTACACAAAACTGAAGAACCTCC
CAGCCAGCAAGGGCTTGANAATTTANCCCATTTCTCACATGTGAAACTGANTCCCANAGAAGGAANAAAGTCTCANCANA
TTCACTTTTGGTGTTGATATGCAATGGTAACCATGGTAACAGATATCCANCCTGTAACGTGTTCTCTAATTATCCCCATT
TGAAGTAATATGCACAGAGAGGTGATACCNCTCCGACAAGGTTACATGGCN
Sequence Type genomic DNA
Unitrap ID UNI32855

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81107796..81108165 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054708 (Ankrd24) NM_027480 ankyrin repeat domain 24 Gene [Source:MGI (curated);Acc:Ankrd24-001]


Sequence tag IST14637A4BBF1
Sequence
GGAGCTGCTGCTCGGCCGTGGCCAGCTGGGCCTCGGCTGCGTGCCTCTCGCTCTTNATAAACAATGCCTCACGCTGCACC
TGTGGCCCAAGCCCATGCNTGACTCTCGGGACATTTANACCCCAAAGTGGCTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81107662..81107799 132
NO GENE  

 
Come back to gene ENSMUSG00000054708


For any suggestions or comments, please send an email to unitrap@crg.es