Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10762H12
Clone ID IST10762H12
Vector VICTR76
Project tigm

Sequence tag IST10762H12HMR1
Sequence
NATCTGCTTCCNGAGCAACCAGGATCTCAGTTGCCTTTCCCCACAAACAAAGGCAAGTCTTAATTCCAGGACGANGGAGA
GTCTGGTAGGGCTCTGGTGCCCAGAACAGGATAGGAGGCCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88298804..88298926 119
NO GENE  


Sequence tag IST10762H12BBF1
Sequence
ATCTGAGGCCTGAGATCCCATTAGAGTCTAGGCCTGTCCAGTAGTCTACCAGAGGAAGCTGAGCTTTGCCAACCATGGGC
ACACGTGCCTGCGTGGGGAGGCCTGAGGTGGTCCAGACCGTGGCACTTACTGTGTGCTTTTCTTTTTTCTTTTCCTTCAT
CCCTTCCTTTTCTCTTTTCTCTTTTCTCTTTTCTCTTTCCTTCCTTCCTTCCTTCCTTCCTTNNNTCCTTCCTTCCTTCC
TTCCTTGTTGTTGCTGTTTTGAGACAGGGTTTCTCTATGTAGCCCTGGCTGTCCTGGAACTCACTCTATATACCAGACTG
GCCTTGAACACTCACAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI33032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88298465..88298805 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es