Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AZ0548
Clone ID AZ0548
Vector pGT0lxr
Project sanger

Sequence tag AZ0548
Sequence
GCCCGCCCTCCACATCCTTCCTCATCTGCATCCTCCTCTCCTACTTTTCTCCGCCCTCGCTCCCAAGCCTCCGCCCATTA
GCCCCCGCCCCCAGTTGCCAGTCCCCAGCAGCTCAGTCTTGCAGTGAGTCCATAGCAAAGCACCAGGAGCCGAGAGCACT
GCCGGCTGTGTTGCCTAGCAAGTATCCGAATGGCTCAGGAGAAAATGGATCTGGATTTTGAGGCTGACACATCTGAGGGG
GCCACCCTGAGACGGTCCAACAGTGCTCCCCTGATCCATGTGCTCAGTGACCTTTCACAGGTTTTTGAGCCATATCCACT
TAGAACTGGGAGGACCAGTACGGCAATTATGAGCCATCATAGCTTG
Sequence Type mRNA
Unitrap ID UNI1853

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50619218..50622339 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036022 (4632404H22Rik) NM_030167 family with sequence similarity 122, member B Gene [Source:MGI Symbol;Acc:MGI:1926005]

 
Come back to gene ENSMUSG00000036022


For any suggestions or comments, please send an email to unitrap@crg.es