Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10763F6
Clone ID IST10763F6
Vector VICTR76
Project tigm

Sequence tag IST10763F6HMR1
Sequence
GGGCCCACATGGGCCAACGATTGGCTGGGAGGATGAGAAAAATGACTTTACAATAATGTTTTCTTTTT
Sequence Type genomic DNA
Unitrap ID UNI15390 UNI31035 UNI32321 UNI32369 UNI33033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32508932..32508999 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024050 (Wiz) NM_212438 widely-interspaced zinc finger motifs Gene [Source:MGI Symbol;Acc:MGI:1332638]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31382412..31382479 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3232935..3233002 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52078768..52078835 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8740277..8740344 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046634 (Pkd1l1) polycystic kidney disease 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2156538]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7802638..7802705 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19014294..19014361 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23579517..23579584 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020010 (Vnn3) NM_011979 vanin 3 Gene [Source:MGI (curated);Acc:Vnn3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5221754..5221821 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 128889174..128889241 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000248 (Clec2g) NM_027562 C-type lectin domain family 2, member f Gene [Source:MGI Symbol;Acc:MGI:3522133]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 14345779..14345846 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070811 (C730007P19Rik) RIKEN cDNA C730007P19 gene Gene [Source:MGI Symbol;Acc:MGI:3690091]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 88594411..88594478 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40553003..40553070 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3329086..3329153 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15919472..15919539 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 110305214..110305281 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6001031..6001098 68
NO GENE  


Sequence tag IST10763F6HMF1
Sequence
GGCCCAACTAGCTTCTGTGGGGCGGAGTCTTAAGACACAGTTTCCCCTGTTCCAGCACAGATGATCTAGTTGTGTGCTGT
ANATGGTGTTTTAAAATGCTGAACAATCAAACCTTAATTTGTATATTAATACTCAATGCCATATCTCTGAGCTCGCAATT
GCTTAAATTGTTCATCCCTCANATACTATTAATTCTCAAATTTACAATTGCTTATGCNNATTTCTAGTTAATAAATAAAT
TATGAACATGTGACTCTTAATAACTTTGCAAGCCTTCTAGTTACAACTGCTCCTTAANAAAATTGATTAAAAGTGCAATT
ANTCNCTGCCCCTTTACAGCCAAGTATTTAAAATGTTTTGTCAACG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114511232..114511596 351
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 88594051..88594415 351
NO GENE  

 
Come back to gene ENSMUSG00000070811


For any suggestions or comments, please send an email to unitrap@crg.es