Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14841H3
Clone ID IST14841H3
Vector VICTR76
Project tigm

Sequence tag IST14841H3BBF1
Sequence
ATTATATGTAAGCACTCTGTAGCTGACTTCAGACACTCCAGAACAGGGTGTCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 47647203..47647260 58
NO GENE  


Sequence tag IST14841H3HMR1
Sequence
ANTAAATAANTAAATCTTTAAAAAACAAAACAACAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGC
AGAGACAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCTAANACAGCCAAGGCTACACAGANAAA
CCCTGTCTCGAAAAACCAAAACCAAACCAAACCAAAACAAAAACAAAANANAGCTAAGTAGGAAAATAAATAAATGCAGT
GGTATTGGAAGTANTANTGAATGCTTGTGGTCCCNNNNCTCANNAANCTGANGCAGGANGATCATTGGAAGTTGGAAGGG
GCCTANGCTGTAAAGCTTTCAAGCAAGGCANCATCAAAAAGTGAAGTTAGACTCCANAAATTGAANGAGATACNNNANGC
GTTTANATGTTTAANGTANTTCNNNNANGCATTNNNACNAAACNNAANTGTTNATTTTATTTGTAACTATGTGTCNCTGN
GTGTCNGTGTGCNTAAATGCNNNGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14841H3HMF2
Sequence
ATTATATGTAAGCACTCTGTAGCTGACTTCAGACACTCCAGAACAGGGTGTCAGATCTCATTACGGATGGTTGTGAGCCA
CCATGTGGTTGCTGGGATTTGAACTCCAGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGC
CCC
Sequence Type genomic DNA
Unitrap ID UNI33034 UNI33035

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 114636515..114636676 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042010 (Acacb) NM_133904 acetyl-Coenzyme A carboxylase beta Gene [Source:MGI (curated);Acc:Acacb-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29797235..29797396 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019715 (Gle1) NM_028923 GLE1 RNA export mediator (yeast) Gene [Source:MGI (curated);Acc:Gle1-001]

 
Come back to gene ENSMUSG00000019715


For any suggestions or comments, please send an email to unitrap@crg.es