Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12862C1
Clone ID IST12862C1
Vector VICTR76
Project tigm

Sequence tag IST12862C1HMF1
Sequence
GTGTTAGATCACAGAAACCTAGGACATGTCTCACTCAATACCTGTGGCTCCTCCCAGCCCTTCTCACACTACTAACTACC
CTAAACCTCTCTCTCCCAGGGTCTGGGCTTCCACTTCCCTTCCCCCAGCTTCAGATTCCACAGCCATTTTGGTTATGTAC
CTTCTAGGTTTCCGGACTAGCTCTTGGATGCTTGGTCCATGGCTCCCCTCTTGGACTACTTGCTACTCCCCTTCTCTTCC
CTACTTGCTCCCTTTCCCCATCCCTCCTCTCTCATGGCCCCATTCAGTCTGCTGGCTATACTTAGTCTAGACCATTCTAG
ATGCTGTCCCTCCCCAATATAATATGTATATGTATATATAAAAATAAAATGTATGTATATTTCTTTCTTTTTTTTTTTTN
NCC
Sequence Type genomic DNA
Unitrap ID UNI14684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32920312..32920710 399
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]


Sequence tag IST12862C1HMR1
Sequence
ACACTATCCAACTTGTTTAATTACTGGGTCATTTCTGTGGCAGANATNTNNNNTCTATCCACNNNANATTTTTCTCCTCC
TGTGTGTAAAGTTGTTCTAANAAACTAGGGTGCCTTAACAAGGATTATTTGCTCAGCTCTTCTTATAGCCATCTGGTAAA
TCCATATGACTTGTTTACATTAATGTTAATATANCANGANCTGACATATGCTACNGTTTTNAANAAACATGGTCTCTANA
CNTANANNNAATGCTTTNNNTNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000014932


For any suggestions or comments, please send an email to unitrap@crg.es