Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14340A9
Clone ID IST14340A9
Vector VICTR74
Project tigm

Sequence tag IST14340A9HMF2
Sequence
TGTCTTGATTCCGGCTTGTTCACTGCATCCAGCTCCCAGTTTCATCCACTTTCCTGCGATGTCCTACTTTCACTTGTCTG
TATGGGTCCTCTACCACATCTTCAGCCAGACCTGTAAGTCTGGTCATTTTTCACTGTGTCTGTAGGGTGTGTGTGTGTGC
ACATAAGG
Sequence Type genomic DNA
Unitrap ID UNI14715

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 96101467..96101633 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041995 (Zbed3) NM_028106 zinc finger, BED domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1919364]


Sequence tag IST14340A9BBF1
Sequence
NGTCTTGANTCCGGCTTGTTCACTGCNTCCAGCTCCCANTTTCATCCACTTTCCTGCGATGTCCTACTTTCACTTGTCTG
TATGGGTCCTCTACCACATCTTCANCCNNACCTGTNANTCTGGTCATTTTTCACTGTGTCTGTAGGGTGTGTGTNTNTGC
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14340A9HMR1
Sequence
CNAGTTTGGTATTCTCCATGTGCCTTANTGGNCAGGCCTGTGTCTCCCCACCCCAGTGTTCAAATGANCTGGCTTGAATG
TCCAAATCCTGCTGATCCTACACTTTGCCCCAANAAAAAAAACCGAATCATGATTGCTGGTGTANCACTGGCCAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87274353..87274505 139
NO GENE  

 
Come back to gene ENSMUSG00000041995


For any suggestions or comments, please send an email to unitrap@crg.es