Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10765B7
Clone ID IST10765B7
Vector VICTR76
Project tigm

Sequence tag IST10765B7HMR1
Sequence
AGTGTTCATATGGTATTAAACAATATGCTTTTTTTCCTTCCAGATTTCAGCGACAGCTGTCTGAGCCCAGCCATCCCTTC
CCTCCTCAGTCAGGAGTTCCTGGAGATAGTCGCCCCAGCTACCACCGGCAGATGTCANAGCCCATTGTCCCCGCAGCTCC
GCCACCCCTTCAGGGATTCAAGCAGGAATACCATGACCCACTGTATGAACATGGGGTCCCTGGGATGCCTGGTCCTCCAG
CACATGC
Sequence Type genomic DNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22401802..22402047 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


Sequence tag IST10765B7BBF1
Sequence
CACTCACTATGATTCAACATTTGGGATTAGCCACCACATCTGGTTTTTAAAAGATAAATTAATTTCTAAATGAAAAAAGT
TCTCACTAATGTAAAATGTTGTTTACTATCAATGTGTGTGCGCCATGTTTATTATCAATGTGTGTGCGCCATGGCTCACG
TGTGACAGTCTGANAATAACGCTGTGGATTCACTTCCATCTCACTGGCCCACAAACTACTTTTGAGAAGAACCANGGACT
TACTTGGTATTGATACATTATCATAAAATGACCGTAATTATAAGAAATGAAAAGTTGATTGGTAGATCAAAGAANCTGAA
TTAATCNAGAACCCTTAATCCTTTTATTACCTGTTAAATNNTTTCAAATGTGTAGGGAAGGCTAGGTTCCATTTTACACT
GCATTCTAACATAAATGTTATGGATGAAAGANTTCACATTATGAAGCANATGTATATGAGAACNNNTGTNCAATTTCNNG
GGTGGGANAANCCGTTTATAAATTANCTNACTAAGANTANAANCCN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22402044..22402568 483
 
EST/CDNA Est Name
  CN674518.1 - CN679481.1 - BI663955.1 - CF893629.1 - CF892779.1 - CN688395.1 - BF165754.1 - CN688251.1 - CF164007.1 - CN678747.1 - CN675479.1 - CN686320.1 - CF736169.1 - CF897846.1 - CN672875.1 - CF165606.1 - CN683096.1 - CF165081.1 - CN673574.1 - CN689748

 
Come back to gene CN674518.1 - CN679481.1 - BI663955.1 - CF893629.1 - CF892779.1 - CN688395.1 - BF165754.1 - CN688251.1 - CF164007.1 - CN678747.1 - CN675479.1 - CN686320.1 - CF736169.1 - CF897846.1 - CN672875.1 - CF165606.1 - CN683096.1 - CF165081.1 - CN673574.1 - CN689748


For any suggestions or comments, please send an email to unitrap@crg.es