Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14415F4
Clone ID IST14415F4
Vector VICTR74
Project tigm

Sequence tag IST14415F4BBF1
Sequence
AACTAAACTGCAATCCTCTGGCGCCACACAGGATGCTCCAGAACGAGCACGTGGGAGACAGACATCATGGCTACCTAACT
CTTCCCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3656082..3656172 91
NO GENE  


Sequence tag IST14415F4HMF1
Sequence
ACTAAACTGCAATCCTCTGGCGCCACACAGGATGCTCCAGAACGAGCACGTGGGAGACAGACATCATGGCTACCTAACTC
TTCCCGGATCCGCAATTCGAAATTCTACTTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3656056..3656171 116
NO GENE  


Sequence tag IST14415F4HMR1
Sequence
GTTTTGTGTTCTCTAGTCGCCATGCACATGTAGTAACCCATGGCTCTTGCCCCGCGGTCTCCTCCCAACCACGTGCAGGA
NAGTATGGACTCCGGAACAAACGTGAGGTTTGGAGGGTCAAGTTTACCC
Sequence Type genomic DNA
Unitrap ID UNI33039

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3656170..3656298 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006333 (Rps9) NM_029767 ribosomal protein S9 Gene [Source:MGI (curated);Acc:Rps9-001]

 
Come back to gene ENSMUSG00000006333


For any suggestions or comments, please send an email to unitrap@crg.es