Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14961A9
Clone ID IST14961A9
Vector VICTR76
Project tigm

Sequence tag IST14961A9BBF1
Sequence
GAGCACTGTCTGCTTTTTAGAGAACTCGGGTTCAATTTTCGGCGCTCATGTANGGGCTCACAGCCATCCATAACTTCAGT
CCCAGGGGACCTGGTGCCCTCTTCTGGCCTCTGCANACACCAGGCATGCATGTGGTGCGCANACATACAGGCAGGCNAAA
GTCACATACATAAAAGTAATCATATACTTCAAATTCCATTNNNNNNCTNANTTCCCCTCTAANTGANTGTGTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14961A9HMR1
Sequence
CTCTTAACTGCTGAGACATCTCTTCAGCCCCAGTAAGAATGGAATTATTAAAAATAATGTTCTCCAGCTGGCTGTGAGGG
TCTCTGATGTCC
Sequence Type genomic DNA
Unitrap ID UNI33040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12940084..12940174 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031442 (Mcf2l) NM_178076 mcf.2 transforming sequence-like Gene [Source:MGI (curated);Acc:Mcf2l-009]


Sequence tag IST14961A9HMF1
Sequence
GCACTGTCTGCTTTTTAGAGAACTCGGGTTCAATTTTCGGCGCTCATGTAGGGGCTCACAGCCATCCATAACTTCAGTCC
CAGGGGACCTGGTGCCCTCTTCTGGCCTCTGCAGACACCAGGCATGCATGTGGTGCGCAGACATACAGGCAGGCAAAAGT
CACATACATAAAAGTAATCATATACTTCAAATTCCATTTTTATTCTCAGTTCCCCTCTAANTGAGTGTGTTTTCCTCTTT
AAACTACNNNNNTNTTCACTACNNGGCANTGCTCAAAGCAAGAANCTCAATTGATCCTGGGANACCANANAGTCTGGTGA
CTCAGGGAAGANANNANNCANGTGACTGGGCGACTGACTGNGCNATGGTGGGANCTNNTGAANANGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031442


For any suggestions or comments, please send an email to unitrap@crg.es