Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12443H7
Clone ID IST12443H7
Vector VICTR76
Project tigm

Sequence tag IST12443H7HMF1
Sequence
ATGTCACGCTTAATATCCAGATAAAAACAATAACTAGGTCATAATTATGCCTAACATAAAATAAATAACTGTACCTTATG
TAACTGTAAATACATTATACATATTAGAATANGTGGCAATTGAGGGACATTCTTTTAGTTTTTCAATCTTCAACATGATA
AGGAAATTGGGAGAAACAAACACAAATATCTGTATACACACATTCTTAAGGAAATCTGACAGAAACAGTCATGTTGCTGA
TAATTAATGGATTGTGCANCTGGTGGTATTTATAACTNCCTCCCTCTACTGCCCATTCTGCATTTTCTTCACCCTCTGTA
ANCN
Sequence Type genomic DNA
Unitrap ID UNI16292

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 54044327..54044647 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004633 (Chn2) NM_023543 chimerin (chimaerin) 2 Gene [Source:MGI (curated);Acc:Chn2-001]


Sequence tag IST12443H7BBF1
Sequence
ATGTCACGCTTAATATCCAGATAAAAACAATAACTAGGTCATAATTATGCCTAACATAAAATAAATAACTGTACCTTATG
TAACTGTAAATACATTATACATATTAGAATANGTGGCAATTGANGGACATTCTTTTAGTTTTTCAATCTTCAACATGATA
AGGAAATTGGGAGAAACAAACACAAATATCTGTATACACACATTCTTAAGGAAATCTGACAGAAACAGTCATGTTGCTGA
TAANNNNNGNNNNNTGCANCTGGTGGTATTTATAACTACCTCCCTCTACTGCCCATTCTGCATTTTCTTCACCCTCTGTA
AGCACCTCANAANGTCNTAGCTCTTTTCCTGGAGGANTCACCCATACCTTCATTCCTGCTGGGTNAGTGCCCTTTGTGAT
CCTGCCTGANTTNNGCTGCTATGGTTTCCCAATGACTTTAATCNCANNNNNNGGCANCACTGANCGATGCCCTAAAGCAN
CTCCCTCNATCCNNTCTTAANCCTCCTTACCTCCNTTGNGGNNAANCNNTCNATTTTCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000004633


For any suggestions or comments, please send an email to unitrap@crg.es