Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10060F5
Clone ID IST10060F5
Vector VICTR75
Project tigm

Sequence tag IST10060F5BBF1
Sequence
ACATCACTCAGCTTGAAACGGGCAGAGTGACAAAACTGTGATTGTCTGGAACTGGCGAAAGGAATGACTCAGTACAGAAC
TCAGTAACAGAAACATTCCAAAAGGAAACGTCCAGCACTCATCTGGCAGGAAGTGAATAAAAGGAGAATGCTGTAACATC
AACCTAGGACGCACCTTTTGTTCTTAAACAAATTCGACACCATTCTCCAGGGACTCCCTGGTTAAGAGTAGCTTTCACCC
TTCATCAAGGAAATGTCTCTTTTCAACAGTCAAAGACCTTTACAGAAACTGCAACTACTCAAAGAGCCCAGCTGTGGAGC
CCAGTTCTAAAGGACACATCTACAGCACAGCCAGTGCGCCTAAGGTTGAGGGAATACTGCAAAGAGGAGACCGAAAGATC
CTAGGAGCCAGAGAACCAGAGAGTCTGCTGTCTAAGCATGAGCTGAACAGGAATGACGCCCTTAAAAAATGCTAATGTGG
ATAGGGTCTTAACTGCAGACCTTGAGGGTGCTAAAGAACCTGAGAGTAAGACATAGTCTTTCTTAGGGAATGCATACCAA
A
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13323584..13324143 558
NO GENE  


Sequence tag IST10060F5BBR1
Sequence
ATGTTTTTTTACCTGACAGCTCACTTTTGACCCAGTGAGGCAATCCATTCTAATATGGTTTCTTTTAACATTTCACAGTG
GCCGTTATATAACATCTCAACTAGGGACTTCTAGACACAGTGCTGTTTATAATAGACGGTGGATTTAAATTTCTAAAGAA
ATTGTCAAGAACTTAAGTAGACTTTAAGATGACATTCTGCAAATTTCAGAATATATTCTATGCTCTATCAAAGATGTTCA
CAGATACTAAGTAAAAATTTTTAACTTACTCTTTTCCCTTTGCTACATTTTGTAAAGATTTATGTAGCTTATAATTTTCT
CGATTTGGGAGTGTGTAGGAGTTTAAGGTTGAGTACAGTGTCAAGGCATACGTTGAAAAAAAGATCC
Sequence Type genomic DNA
Unitrap ID UNI24534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13324140..13324525 386
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079844 (Mkl2) NM_181860 MKL/myocardin-like 2 Gene [Source:MGI (curated);Acc:Mkl2-004]

 
Come back to gene ENSMUSG00000079844


For any suggestions or comments, please send an email to unitrap@crg.es