Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13746D2
Clone ID IST13746D2
Vector VICTR74
Project tigm

Sequence tag IST13746D2BBF1
Sequence
CCTAAACTGTCCACCAGTCCTAAGCCGGAAGGAGGTGGGGTCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI33041

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29477958..29478005 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037463 (Fbxo27) NM_207238 F-box protein 27 Gene [Source:MGI (curated);Acc:Fbxo27-001]


Sequence tag IST13746D2HMF1
Sequence
CCTAAACTGTCCACCAGTCCTAANCCGGAAGGAGGTGGGGTCTGGATCCACAGGGCTGGACATTCGGCGAATCTCANAGA
GGTTTCGCCTGGGAAGGATAGTATTAGGCAAAGCTATAGCTATGCGGTCCTCCAGGCCGCGAAGGGGAGCTGGCAGGGGT
GCCGGTGAGCACCAGCGGGCTGGGAGGAGGGTAGGCTTTGGGGACAGAGAGGCGGTAAGGGACGTGNNANANAGTGGAN
Sequence Type genomic DNA
Unitrap ID UNI33041

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29477958..29478195 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037463 (Fbxo27) NM_207238 F-box protein 27 Gene [Source:MGI (curated);Acc:Fbxo27-001]

 
Come back to gene ENSMUSG00000037463


For any suggestions or comments, please send an email to unitrap@crg.es