Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14583C3
Clone ID IST14583C3
Vector VICTR74
Project tigm

Sequence tag IST14583C3HMR1
Sequence
AAAAGTATTTTTTTAACATTTATTTTTATGGGCATCGGTGTTTTGTGGGCATGTATTTCTGTGCACCACATCTGTGCATT
AGCTGCAGAGGCCAAAAGAGGGCATTGTATCTCTTAGGACTGAAGTTACAAACTTTTGCAAGTTGCCATATGGGTGCTAG
GAATTGAACCTGAGTCCTCTGCAAGAACAGACAGATACTCTTATCCACTGAACCATCATCTCTCCANCCCNTTGNCCN
Sequence Type genomic DNA
Unitrap ID UNI10857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36073045..36073281 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075229 (Ccdc58) NM_198645 coiled-coil domain containing 58 Gene [Source:MGI Symbol;Acc:MGI:2146423]


Sequence tag IST14583C3HMF1
Sequence
TTTTTGGCCTAATTATTTACCAAATAAATCAATTTGGTGAGGTTATCTTCAAGAATACCACTACCTACAAGCTACTCAAA
GTATTACGGTTACTACAGATAGGGAAATGACATGTTTAACAAATTTTACTATCTCTACTTAAAATACACTTTTAAAGGTC
ATGTTTTTTTGTTTTTTTGTTTTTTTGTTTAGCTTCAACTCTAATTTAATAGCAGAACCATCATTGTGAATTGATCAACA
TCCGGATCGTTATTCTTGAATTCTTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36072781..36073048 268
 
EST/CDNA Est Name
  AI428927.1

 
Come back to gene AI428927.1


For any suggestions or comments, please send an email to unitrap@crg.es