Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G038H09
Clone ID G038H09
Vector U3CEO
Project ggtc

Sequence tag G038H09
Sequence
GCACACCAGNNNGCGACCCTGGCTATCAGCCTACACCAGGGGGCGGGTGCCAAGATGTGGATGAATGCCGGAACCGGTCT
TTCTGCGGCGCCCATGCTATGTGCCAGAATCTGCCTGGGTCCTTTCAGTGCGTCTGTGACCAAGGCTACGAAGGGGCACG
GGACGGACGTCACTGCGTGGATGTGAATGAGTGTGAGACACTACAGGGCGTGTGTGGCTCCGCGCTGTGTGAAAATGTTG
AAGGCTCCTCTCCTGTGTGTCTGCCCCAATAGACCCTGAGGAATTTGATTCCCATGAACGTGGACGNNTGTGCGTCNNNC
CTCGGTGCGTCCGGCGGGTTGCCGC
Sequence Type mRNA
Unitrap ID UNI11232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28099282..28104697 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es