Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G038C11
Clone ID G038C11
Vector U3CEO
Project ggtc

Sequence tag G038C11
Sequence
TAGTATAAACCTCCAGGTTGTACAGGAGAAGGCACCGGGAGAGGAGAGGTCCGGTGATGGGTGAGCAGGAGGCCGCGAGA
AACAACAGCAGGCTTCTGGTCTGTGGCAGGCAAGAGAATTCTGCCCCTGAGGCATGGCCGGAAGACAGAACTAGCTGAGT
GCTTCAGTCTGCAGAAGTCTTTCAGGATTCAGCTGAGGTGGGCCTCAGTCGGCAGACAACATGCTCCTGGCTCTGGGACT
CAGCGCTGGTGCTCTATGCAAGCCTCCAGGCTGAGGACAAACGT
Sequence Type mRNA
Unitrap ID UNI10799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106576218..106585743 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es