Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13064C3
Clone ID IST13064C3
Vector VICTR76
Project tigm

Sequence tag IST13064C3HMR1
Sequence
AAAGCAATGTGTGATCGATGACCGAGCTGCCCGGCTGGACAGTAAGTAAACCCCTGATAGCTTGCTCACACCTTATTTCT
AAAATGCTCTGGCTTTCAANNGTNGCATTTGATGTTCCTCAGGTTAAGTAGTACAACTGAACTATTAGATAATCTTAATA
TAAACCTTTTATTAACTCTGGGGTTCAAACAGCAGGCCTTGCACATGCTTGGCAAGGTCTCTCCCTCCGAGCTAGCCCTG
GA
Sequence Type genomic DNA
Unitrap ID UNI2855

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 121203646..121203886 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055723 (Rras2) NM_025846 related RAS viral (r-ras) oncogene homolog 2 Gene [Source:MGI Symbol;Acc:MGI:1914172]

 
Come back to gene ENSMUSG00000055723


For any suggestions or comments, please send an email to unitrap@crg.es