Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15051D10
Clone ID IST15051D10
Vector VICTR80
Project tigm

Sequence tag IST15051D10HMR1
Sequence
GGCAGGAAATGCTATGGAAGAGAATGTCTCANAGGCCAGAATAAACCCATTCTCATTCCTATTCATTCATATTCTCACTT
TCAAAAACACATTCACAAGTCTGTAGAAGAGCTAGACAGACTAAATCCAGCTGGCTCAATTCTGTCATAAACTTGGGCAC
AGAAAGCGTAAGGAAAGGAAGTGTGTCAGGTTGTGTCACAGTTCTGCTGGCTGAGTTGATGGAGGAAGGAGCATATGGCC
GCACTGGAGCCAAGAAGTCGGCACCATGGGCAACCTGAGGGTTGTGCTCCAAGCGCCACCACTCCCTTATCAATGCAGAA
TGGCTGCTGGGTTTGAAGCTGCCTCCAAAGCCCAGTAGGTTTCAATGGCCTAAGAGTGGAGCATTTGTATCAGCAAGATA
ACTGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48546519..48546926 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023994 (Nfya) NM_010913 nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]


Sequence tag IST15051D10HMF1
Sequence
CTGCCCATTTACATGGCACAGAAGTAGCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15051D10BBF1
Sequence
CTGCCCATTTACATGGCACAGAAGTAGCTGGCCAGCACTTAGAATCTTCAAAAGCTGAAATGCCCAGAAATGCTCCTACA
ATAAGCATCTGATCACCGCAGTCCATCTGACCTGGCATCACACACACACACCCAGCTAGGGCCTTTGAAGGCTCCAGTGT
GCTCCTTGTCTCCACTAAGGAGATAGCATGAACTAAATAACAAAACAAGTTAACTTCAAAGAGGCTTTTAAGTCTAAAAA
GGAACAAAAATGTGTATTAGACTCCTAAAGGGAAATACAGTAAATGGAGTTTGGGGGACAGAGGCTTTTCCACTGGGGAC
AAACCAAGGAAAGCACTGGGAAAGGGTGTCATGTGAGTTAGGTTTAAGTCTGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48546922..48547299 378
 
EST/CDNA Est Name
  BM022832.1 - BY704929.1 - BY094489.1 - BB857196.1 - AW519403.1 - BY079648.1 - BY204254.1 - BY079417.1 - BY344905.1 - BY344895.1 - BY206151.1 - BY222131.1 - BY213644.1 - BY215257.1 - BY233161.1 - BY126183.1 - BY184701.1 - BY774721.1 - BY343980.1 - BY257491

 
Come back to gene BM022832.1 - BY704929.1 - BY094489.1 - BB857196.1 - AW519403.1 - BY079648.1 - BY204254.1 - BY079417.1 - BY344905.1 - BY344895.1 - BY206151.1 - BY222131.1 - BY213644.1 - BY215257.1 - BY233161.1 - BY126183.1 - BY184701.1 - BY774721.1 - BY343980.1 - BY257491


For any suggestions or comments, please send an email to unitrap@crg.es