Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13031B5
Clone ID IST13031B5
Vector VICTR76
Project tigm

Sequence tag IST13031B5BBF1
Sequence
GGATCATTATTTTGAAGTTCATCTTTATGTGCATCAAAATTTTTACCTTGTTGCTAATGTTCTATCGTGTGGAATGCAGT
ATATATAGTTTTCTTACCTGCTCACCTGTTCATAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI5670

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108947234..108947352 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068184 (Ndufaf2) NP_001120818 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2 Gene [Source:MGI Symbol;Acc:MGI:1922847]


Sequence tag IST13031B5HMR1
Sequence
NTGTTTTACACAGAANGAGACGGGCAGCCNGAAGAGCCCTTGTTCTCTGTCCGTTCCCTANTTTCCCCAATCAAAAGGTG
AGATGGCCTCTGTTCCACTGTGGGGAGGGAAGACNGGTGANCCGGGANACATGGCCCCGTCCTGTANCTCTCCTGCCTTC
ATGCNNNTCTTCTCTCTTTTTAAAATCACTCTNNNCTTANCCACATCANCTTTTACNNGANCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13031B5HMF2
Sequence
CAGNNAGGCTAGAACAGATGGCATCAGATCAGATTCTGTGAGTGTTGGCATAATCCATGGAAAACACAGCTGCCTCCTGA
CCTANTGCTGACGTGGA
Sequence Type genomic DNA
Unitrap ID UNI8288

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 154892654..154892749 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042751 (Nmnat2) NM_175460 nicotinamide nucleotide adenylyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2444155]

 
Come back to gene ENSMUSG00000042751


For any suggestions or comments, please send an email to unitrap@crg.es