Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G032E02
Clone ID G032E02
Vector U3CEO
Project ggtc

Sequence tag G032E02
Sequence
TGCGGGAGGGGAAGAGGAGAAACCTTGAGGTGGGAGAGGAGAAGGCACCTTGAGAGGAGAGCAGGCTTTTGGTCTGTGGC
AGGCAAGAGAATTCTGCCCCTGAGGCATGGCCGGAAGACAGAACTAGATGAGTGCTTCAGTTTGCAGAACTCTTTCAGTA
TTCAGCTCACCGCCCCCTCAATTACGAGGGCGGGGGCAGGGGGGATCGGGGTTCCAGCGCTGGTGCTCTATGCAAGCCTC
CAGGCTGAGGAAAACT
Sequence Type mRNA
Unitrap ID UNI10799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106576216..106585751 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es