Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14529H9
Clone ID IST14529H9
Vector VICTR74
Project tigm

Sequence tag IST14529H9HMR1
Sequence
GGTTTCTCTGTGTATCTTTGGCTATCCTGGGACTTACTCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34936448..34936490 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


Sequence tag IST14529H9BBF1
Sequence
AACCCTGTCTCAAAAAGACAGAATATATAGTTAATTAATTAATTAATTTAGGCAGGAGCAGTGATGCATTTCTTTAATGC
CAGCACTCAGGAGGCAGAGGCAGGCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34936341..34936451 111
NO GENE  


Sequence tag IST14529H9HMF1
Sequence
AACCCTGTCTCAAAAAGACAGAATATATAGTTAATTAATTAATTAATTTAGGCAGGAGCAGTGATGCATTTCTTTAATGC
CAGCACTCAGGAGGCAGAGGCAGGCAGATCTTCGTGTTCAAGGTCAGCCTGGTCTACATACAGTAGTGTTCCAGGACAGT
CAGAAGTACATAAAGGGTCTTTGTTCTGTTTGTTTTAATTCCACTGAAGTTGATATCCATTATCTTCACATGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34936215..34936451 237
NO GENE  

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es