Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14620C4
Clone ID IST14620C4
Vector VICTR74
Project tigm

Sequence tag IST14620C4HMR1
Sequence
TCTTTGACAGAGGCCTGAAACTATACCAAGATGGCAGCCATAACAAGTGGGAGAATACAGATGAATAAGTCC
Sequence Type genomic DNA
Unitrap ID UNI33054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31828507..31828577 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053134 (Supt7l) NM_028150 suppressor of Ty 7 (S. cerevisiae)-like Gene [Source:MGI (curated);Acc:Supt7l-002]


Sequence tag IST14620C4BBF1
Sequence
AAGAGTTATAATATTAACTATGGCTTAGTTCAATTTTCCATAAATTTTATGACAAATTAACACTACTATTTCCAATTTTT
CAGATGTGGAAGCTGTTGTCCAGGGTCATGCCAACATCATAAATACAAAGAGTAAAAAAGAAAAGAGGTTTCGATGCTCA
GGTTTGTTAAGCCACTAAACATGCTATCTCAATATTTTGTTCCGAGTAATAAAAGAATGAACAATAATAAATTGCTTCTT
TACTAACTTCATAAAAGGAATAAATTCGAGAGCTGCAGATAGGGACTCCTTGCTCCGGATCTGGAGGCTTAGGCTTAGGC
GCCGACCACAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31828574..31828908 335
 
EST/CDNA Est Name
  AA438245.1 - AW989127.1 - BQ886681.1 - AW320663.1 - CJ075962.1 - CJ086700.1 - CJ085906.1 - BY124609.1 - AA647817.1 - BY009972.1 - BY007987.1 - BY129485.1

 
Come back to gene AA438245.1 - AW989127.1 - BQ886681.1 - AW320663.1 - CJ075962.1 - CJ086700.1 - CJ085906.1 - BY124609.1 - AA647817.1 - BY009972.1 - BY007987.1 - BY129485.1


For any suggestions or comments, please send an email to unitrap@crg.es