Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10105C7
Clone ID IST10105C7
Vector VICTR76
Project tigm

Sequence tag IST10105C7BBF1
Sequence
AGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAG
ATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI12672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55580632..55580718 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18030934..18031020 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]


Sequence tag IST10105C7HMF1
Sequence
TAANAAGTTGGGGGACGCCGACCGCTCGGGGGTCGCGTAACTAGTTAGCATGCCAGAGTCTCGTTCGTTATCGGAATTAA
CCAGACAAATCGCTCCACCAACTAAGAACGGCCATGCACCACCACCCACGGAATCGANAAAGAGCTATCAATCTGTCAAT
CCTGTCCGTGTCCGGGCCGGGTGANGTTTCCCGTGTTGAGTCAAATTAAGCCGCAGGCTCCACTCCTGGTGGTGCCCTTC
CGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 39984509..39984750 236

 
Come back to gene Mmu.3072


For any suggestions or comments, please send an email to unitrap@crg.es