Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14465A1
Clone ID IST14465A1
Vector VICTR74
Project tigm

Sequence tag IST14465A1HMF1
Sequence
GGAGATGGCTTAGTTGATAAGCTGCAAAAACATTATGACCTGAGTTTGGGTTCTTAGCATCTGTATAAAGTTCTCTGTAC
AGCAGTGAGTGCCTATAATCCCAGGGCCAGGGAGGTGGAGACAGAGAGGCTCTGGGGACT
Sequence Type genomic DNA
Unitrap ID UNI33057

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3601520..3601659 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044433 (2310057J16Rik) NM_027171 RIKEN cDNA 2310057J16 gene Gene [Source:MGI Symbol;Acc:MGI:1916947]


Sequence tag IST14465A1HMR1
Sequence
NTGATTGATCTGTACTGTGCCCAGAAAGTGTTCCGAGTCNGAGAACAAAATGTCTAACACGCGTTACAAAGTAGAAGCAN
AATTGGACGTTGCTCCATCTCTTCTGCCTTGTGGATACTGGTGTCTGAACTTGAGTTGTCAGGCTTGGTAGCAAATGCCT
TTTCCTGCCTAGCCATCTCACCANCCTGAACACTANACTGTTAGTGAATTTCTGGGGATTGTGGCTAANGCTAGGCTCCA
GGGCTTANAGCATTCTAGGCACGTGCTCCCCTCCACAATGACNTGCCCTCGTCCATTTTGAAAATTNNNTTCCCCTTTGG
TTTTANTTTCCTTGGATTTTATTTATTACANANNNNCNATCCAGGTTGAAAAAATANTTTTTTAANTACAAAAAANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000044433


For any suggestions or comments, please send an email to unitrap@crg.es