Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F15019
Clone ID F15019
Vector pT1ATGbetageo
Project ggtc

Sequence tag F15019
Sequence
CCTTTAGGCCGTCCCTGAGGAGCGCCTGAAAGCATTATTAGTGGGGCTGCCCTGATGGCTGACTCATCCTGCACACGTGA
TGACCGTCGGGAGCGCATTGTGGCAGAGTGTAATGCTGTCCGCCAGGCNNNACAGGACCTGCTCTCAGAATACATGGGCA
ACGCTGGACGTAAAGAAAGAAGTGATGCACTCAACTCTGCAATAGATAAAATGACCAAGAAGACCAGGGACTTGCGTAGA
CAGCTTCGCAAAGCTGTCATGGACCACGTATCAGATTCTTTCCTGGAGACCAATGTCCCTCTATTAGTACTGATTGAAGC
TGCAAAGAATGGAAATGAGAAAGAAGTTAAGGAATATGCCCAAGTTTTTCGTGAACATGCCAACAAACTGATTGAGGTTA
CCAACCTGCCCTGTTCAATCTCCAACAGTGAGGAAGGCGTGAAGCTTGTCCGAATGTCTGCAAGCCAGTTAGAAGCGCTG
TGTCCTCAGGTTATCAATGCTGCATTGGCGTTGGCAGCAAAGCCGCAGAGTAAACTGGCCCAAGAGAACATGGATCTTTT
TAAAGAGCAATGGGAAAAGCAAGTCCGTGTTCTCACAGATGCTGTTGATGACATTACTTCCATCGATGACTTCTTGGCTG
TCTCAG
Sequence Type mRNA
Unitrap ID UNI12319

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35342045..35399193 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037815 (Ctnna1) NM_009818 catenin (cadherin associated protein), alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88274]

 
Come back to gene ENSMUSG00000037815


For any suggestions or comments, please send an email to unitrap@crg.es