Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F15284
Clone ID F15284
Vector pT1ATGbetageo
Project ggtc

Sequence tag F15284
Sequence
CTTAGGGTTTGAGTGANNACNNGNNNNGGAGCAGTACTAAATCTCTTGCGGAGGGAGGTTTCAGAGCATGGACGTCATTT
ACNNCAGTATTTCAACTTGTTCGTAATGTATGCCAATTTAGGAGTGGCAGAGAAAACACAGCTGCTCAAACTGAGTGTAC
CTGCTACCTTTATGCTTGTGTCCTTAGATGAAGGTCCTGGCNNNTCCAATTAAATATCAGTATGCTGAATTAGGCAAATT
ATACTCAGTAGTGTCACAGCTCATCCGCTGTTGCAATGTCTCTTCAAGAATGCAGTCTTCGATCAATGGTAATCCTTCTC
TTCCAAATCCTTTTGGTGATCCTAACTTATCACAACCTATAATGCCAATTCAACAAAATGTGGTAGACATTTTATTTGTG
AGAACAAGTTATGTGAAGAAAATTATTGAAGACTGCAGTAACTCTGATGAGACCGTCAAATTGGTTCGCTTATGCTGCTG
GGAGAATCCTCAGTTGTGATCTACTGTCCTCAGTGAACTTCTTTGGCAGGTTGCATATTCTTATACTTATGAACTCCGGC
CCTATTTGGATCTGCTTTTACAAATCTTACTGATTGAAGACTCTTGGCAGACTCACAG
Sequence Type mRNA
Unitrap ID UNI12320

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12736937..12738837 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es