Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14230D2
Clone ID IST14230D2
Vector VICTR74
Project tigm

Sequence tag IST14230D2HMR1
Sequence
CCAGAACATTGGTNAGGAGGCTGTTGCCAGTCATAGCTGTTAAGAACGGGTGGGAACATGCTAGGAGATATATCTTTGAA
GGTCATTTATGCTGGTGAACGTAAATATATGACTTTAAATTGGCTTTGTTTGGCTTTTTGAAACTGCAGTCCAGGGTGGC
CTTGANCTCCTTTATAACTTTGAACTCCAACCCCTCTGCTTCTCTCTCCCTAGTTTTGAGGTTACANAAGTGCTCCCCCA
CGCCCANATAGCTCTTTAAGTTTCATCTTTTCTTTTGGGAACAGGGATCATCGCTATGGCCCTGGCTGTCCTGGAAGTCA
CTATGTGGTACAGGCCTCANCCTCTCANNNGTCCACCGGCTTCTGTCTCCCGCGGGCTTGGATTAAATGTGTGTGCACCA
GCACACCTGGCCTTATTTTAAATTTTTAATATGGTATTTTTTTCTAANAAAGTAATCTTTCCTTAATCGTCTGANATGTA
TNATCCNNTNTANNTGTTN
Sequence Type genomic DNA
Unitrap ID UNI4925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71175620..71176117 466
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]


Sequence tag IST14230D2HMF1
Sequence
CTGGATCCTTCCCGCCTTCCTCCATCATTCTTTAAACTGTAGCCAGGGGGCTTCTTAAAACTCTCCCCAAAACAAAAGCC
TTTGCAATTTGATTCACTTACCAGATAACTCATGCTTAAGGTGCACAATCCAATGGCAGTTTTGGCACATGGGTGTCTCA
CCATGCTCTCTGACAGAACACTCTCTTCGCCTAAAAGAGGAACTCTAAAACCTGCACAGTCATCCCGTTTTCTCCGTTCC
CTGACTTTCTGTTCCCCTTCTACTCTCCAGTCGGTGAAGGCCACTTCCCTTTAAGTCTCTAAACAGTTACCTGCCATGGA
CGAAACTTTCTGTATTCTCCTATCTGGCTGCAATCACACACACGCCTCCCCTACCATCTCCATGCCCATCCACACGCANG
TACCAACCGACACCCACTTCCTACTTCCTCANTGCTCTGCTGAATGGCTGANCTGAACNGTCTCTCCANCCCCNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71176114..71176586 463
 
EST/CDNA Est Name
  BG919080.1 - BI649238.1 - CX123714.1 - BE912090.1 - BY734667.1 - BB618078.1 - CJ092515.1 - BB653264.1 - BF137858.1 - CX123275.1 - BQ942112.1 - BU918225.1 - BE533043.1 - CA555919.1 - BE310301.1 - BF142058.1 - BB852770.1 - BY269876.1 - BY258620.1 - BY296846

 
Come back to gene BG919080.1 - BI649238.1 - CX123714.1 - BE912090.1 - BY734667.1 - BB618078.1 - CJ092515.1 - BB653264.1 - BF137858.1 - CX123275.1 - BQ942112.1 - BU918225.1 - BE533043.1 - CA555919.1 - BE310301.1 - BF142058.1 - BB852770.1 - BY269876.1 - BY258620.1 - BY296846


For any suggestions or comments, please send an email to unitrap@crg.es