Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F15315
Clone ID F15315
Vector pT1ATGbetageo
Project ggtc

Sequence tag F15315
Sequence
CCCGAGGGGGTCATGGTGGCGCCCCAGTGCGGAGCCGGACCGGCGGCAGCCGCCGAAGCATGTAGAAGGGGTACGGCGCG
AGCCCCCCACGGTTTCGCG
Sequence Type mRNA
Unitrap ID UNI12322

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40603778..40603876 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019831 (Wasf1) NM_031877 WASP family 1 Gene [Source:MGI (curated);Acc:Wasf1-001]

 
Come back to gene ENSMUSG00000019831


For any suggestions or comments, please send an email to unitrap@crg.es