Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10235C6
Clone ID IST10235C6
Vector VICTR76
Project tigm

Sequence tag IST10235C6BBF1
Sequence
CTANNTGGTTCGATTAGTCTCTCGCCCCTATACCCAGGTCGGACGACCGATTTGCACGTCAGGACCGCTACGGACCTCCA
CCAGAGTTTCCTCTGGCTTCGCCCTGCCCAGGCATAGTTCACCATCTTTCGGGTCCTAACGCGTACGCTCGTGCTCCACC
TCCCCGGCGCGGCGGGCGAGACGGGCCGGTGGTGCGCCCTCGGCGGACTGGAGAGGCCTCGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391465..57391690 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]


Sequence tag IST10235C6HMF2
Sequence
NNGTCATGTTATAGTGTTGCCTAATTGTCCTTTCTTTTTTCAATCCTCACTCCCTCCCTTGACACCCTGCTGACTGAGTG
AGCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35994552..35994632 81
NO GENE  

 
Come back to gene ENSMUSG00000075007


For any suggestions or comments, please send an email to unitrap@crg.es