Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F15253
Clone ID F15253
Vector pT1ATGbetageo
Project ggtc

Sequence tag F15253
Sequence
ATGATCCCAATTTCCAGATGCCTTGTTCAACAGTTGTTGGTCTTGACGATATTATGGATGAAGGAGTTGTTAAAGAAAGT
GGTAATGATACCATTGATGAAGAAGAATTGATTTTACCTAACAGGAGTTTGAGGGACAGAGTAGAAGACAATTCAGTAAG
ATCACCAAGAAAATCACCTCGTTTAATGGCACAAG
Sequence Type mRNA
Unitrap ID UNI5433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30893950..30919864 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]

 
Come back to gene ENSMUSG00000048874


For any suggestions or comments, please send an email to unitrap@crg.es